Skip to main content
U.S. flag

An official website of the United States government

Exercise 1: Identify a nucleotide sequence


Background

We'll begin by finding the best match to an "unknown" 140bp nucleotide sequence, then review the results page, and explore report and download options.

Setup

  • Query:
TACCCCAAAACACTGTTTTTACTTCGTGGAAATCATGAATGTAGACATCTAACAGAGTATTTCACATTTA AACAAGAATGTAAAATAAAGTATTCAGAACGCGTATATGATGCCTGTATGGATGCCTTTGACTGCCTTCC

  • Settings: Default, except add an Organism limit, eukaryotes (taxid:2759)

Results

  • RID: KNWN00VF016
  • Review the results page:
    • Query coverage; Percent identity; sorting
    • RID; reports; downloads

Take-away Message

  • The query has exact, full length matches in numerous primates
  • The query is all CDS (coding sequence), in the PPP3CA gene
  • BLAST results offer many viewing options
  • Use the RID number to share and retrieve results (within about 36 hours)

Last Reviewed: October 6, 2022