Exercise 1: Identify a nucleotide sequence
Background
We'll begin by finding the best match to an "unknown" 140bp nucleotide sequence, then review the results page, and explore report and download options.
Setup
- Query:
TACCCCAAAACACTGTTTTTACTTCGTGGAAATCATGAATGTAGACATCTAACAGAGTATTTCACATTTA AACAAGAATGTAAAATAAAGTATTCAGAACGCGTATATGATGCCTGTATGGATGCCTTTGACTGCCTTCC
|
-
Settings: Default, except add an Organism limit, eukaryotes (taxid:2759)
Results
- RID: KNWN00VF016
- Review the results page:
- Query coverage; Percent identity; sorting
- RID; reports; downloads
Take-away Message
- The query has exact, full length matches in numerous primates
- The query is all CDS (coding sequence), in the PPP3CA gene
- BLAST results offer many viewing options
- Use the RID number to share and retrieve results (within about 36 hours)
Last Reviewed: October 6, 2022