We'll cover three main examples today and explore options and some related resources. We'll use Primer-BLAST to design primers for:

1. A human transcript from the myeloperoxidase (MPO) gene and use the exon/intron selection to make them specific for the transcript
2. A specific exon of the human MPO gene that contains a clinically significant SNP 
   1. Starting from the nucleotide record
   2. Starting from the sequence viewer
3. A set of whale myoglobin transcript sequences to generate cross-species primers and use these to identify the myoglobin gene in an unannotated grey whale genome assembly

Today's results job IDs

Example 1: Human MPO mRNA

General primers

• Use the provided defaults and design primers for human myeloperoxidase mRNA (NM_000250). You can use the Pick Primers link to send the sequence to Primer-BLAST as a template. Expand the Advanced Parameters to generate an internal hybridization oligo as well. 

Pre-configured Primer-BLAST form with MPO mRNA, no exon/intron selection.

Pre-configured Primer-BLAST form as above with internal hybridization oligo.

• Check your primer pair 2 against “Genomes for selected organisms” see if they would amplify human genomic DNA.

Single exon pair 2
ATCCCCGGGACTTTGTCAAC 
GGGCCCATAAGTCAACCACA

Pre-configured Primer-BLAST form with single exon primer pair.

Expression-specific primers

• Re-design primers with the “at least one intron” check box selected.

Pre-configured Primer-BLAST form with skip one intron checkbox checked.

• Check the new primer pair 5 on genomic DNA by searcing “Genomes for selected organisms” limited to human.

Different exon pair 5
GCATCAAGAACCAAGCCGAC     
CATGGGCTGGTACCGATTGT

Pre-configured Primer-BLAST form with primer pair 5 against human genomic DNA 

• Try primer pair 5 against RefSeq RNA restricted to Primates to see if they would work in other species.

Pre-configured Primer-BLAST form with primer pair 5 against primate RefSeq mRNA

Example 2: Primers for MPO exon with pathogenic SNPs

From the standard Entrez display

• Perform an “All databases” search on the NCBI homepage for MPO
• Click the button on the results panel to retrieve the human MPO RefSeq Gene record
• Navigate to exon 10 in the FEATURES table of the record
• Click on the linked “exon” feature to highlight it then display it in FASTA or GenBank format
• Click the “Pick Primers” link on the right-hand side to send the exon 10 sequence to Primer-BLAST
• Adjust the primer ranges so that primers are within 100 base pairs upstream and downstream of the exon (e.g., 12918 To 13018, 13188 To 13288)
• Search against “Genomes for selected organisms”
• Run the search (Get Primers)

Your search will be interrupted by an intermediate page (screenshot below). This is because the template RefSeq Gene record is not in the genome database. Primer-BLAST will offer the identical region of chromosome 17 as an alternative match. Check the box for NC_000017.11 and click "Submit."

• Once the results load, you can use "Tracks -> Configure tracks" menu on the Primer-BLAST graphical view to add the Clinical Variants track to see clinical SNPs that are present in the exon.

Pre-configured Primer-BLAST form with MPO exon 10 and primer binding regions

  

Graphical Primer-BLAST results showing the Clinical SNPs track with variants in exon 10 of MPO

 

From the graphical sequence viewer display

• Click the "Graphics link" on either the FASTA or GenBank display of exon 10 from the MPO RefSeq Gene to load the graphics view.
• Use the zoom feature to zoom out to get flanking intron sequence on either side of exon 10.
• Click in the ruler and drag out a 100 bp selection upstream of exon 10.
• Hold the Ctrl key down and drag out a 100 bp selection downstream of exon 10.
• Use the pop-up menu to “Primer BLAST” the selection.

  

Sending flanking sequence of exon 10 of MPO to Primer-BLAST from the graphical sequence view

• The primer BLAST results load into the graphical sequence viewer as shown in the screenshot below

 

Example 3: Making Common Primers for a Set of Related Sequences (whale myoglobin transcripts)

Designing common primers

• Select the "Primers common for a group of sequences" tab on the Primer-BLAST form.
• Copy and paste the following accession numbers for whale myoglobin transcript sequences into the template box on the Primer-BLAST page.

XM_007165704.1
XM_022599904.2
XM_036866958.1
XM_004286206.2
XM_030855394.1
XM_027108256.1
NM_001290722.1
XM_032646419.1
XM_024743462.1
XM_007456255.1

• Use the RefSeq mRNA database with an organism limit to whales (cetacea).
• Run the search.

Pre-configured Primer-BLAST page for whale myoglobin transcripts

• Note that the search finds additional whale myoglobin transcripts (unintended targets).
• Re-run the search after accepting the additional transcripts as shown below.

Testing whale myoglobin primers in the grey whale assembly

• Perform an "All Databases" search for grey whale from the NCBI Homepage.

• Follow the link to Genomes to see list of genome assemblies and copy the assembly accession for the reference genome (GCA_028021215.1). You'll use this as a Custom database in Primer-BLAST.
• Open the Primer-BLAST submission form , select Custom as a Database option and enter the grey whale assembly accession in the box.

• Use your primer pair 4 from the previous example to search the assembly. This primer pair should bind within the last exon based on the conserved structure of mammalian myoglobin genes and should work in genomic DNA.

Primer pair 4, last exon
ACTGTTCCGGAAGGACATCG
GAGAGCCAAGCTTCTCCTG

Preconfigured Primer-BLAST form with myoglobin primer pair 4
Note: There is no way to set the custom database. You will need to enter the assembly accession, GCA_028021215.1, in the Custom box.

Verifying the myoglobin gene in the identified grey whale sequence

• Retrieve the grey whale contig MB region NIPP01005289.1 : 123350 to135659.
• Click the “Run BLAST” link on the right-hand side of the sequence record
• Choose the Reference RNA sequences (refseq_rna), organism limit Cetacea
• What gene products does the search find?

Pre-configured nucleotide BLAST form with the grey whale contig, RefSeq RNA database, cetacea organism limit

Grey whale MB region nucleotide results, RID=GW79TEEF013